Direkt zum Inhalt
Merck
Alle Fotos(1)

Key Documents

EHU032851

Sigma-Aldrich

MISSION® esiRNA

targeting human CBL

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CATCCTGGCTACATGGCTTTTTTGACGTATGACGAAGTGAAAGCTCGGCTCCAGAAATTCATTCACAAACCTGGCAGTTATATCTTCCGGCTGAGCTGTACTCGTCTGGGTCAGTGGGCTATTGGGTATGTTACTGCTGATGGGAACATTCTCCAGACAATCCCTCACAATAAACCTCTCTTCCAAGCACTGATTGATGGCTTCAGGGAAGGCTTCTATTTGTTTCCTGATGGACGAAATCAGAATCCTGATCTGACTGGCTTATGTGAACCAACTCCCCAAGACCATATCAAAGTGACCCAGGAACAATATGAATTATACTGTGAGATGGGCTCCACATTCCAACTATGTAAAATATGTGCTGAAAATGATAAGGATGTAAAGATTGAGCCCTGTGGACACCTCATGTGCACATCCTGTCTTACATCCTGGCAGGAATCAGAAGGTCAGGGCTGTCCTTTCTGCCGATGTGAAAT

Ensembl | Human Hinterlegungsnummer

ENSG00000110395

NCBI-Hinterlegungsnummer

NM_005188

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... CBL(867) , CBL(867)

Verwandte Kategorien

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Ying Hong et al.
Neurology. Genetics, 6(4), e448-e448 (2020-07-09)
To report a series of patients with cerebral arteriopathy associated with heterozygous variants in the casitas B-lineage lymphoma (CBL) gene and examine the functional role of the identified mutant Cbl protein. We hypothesized that mutated Cbl fails to act as
Shimei Chen et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 132, 110856-110856 (2020-10-31)
The incidence of retinopathy of prematurity (ROP) has increased continuously in recent years. However, the therapeutic effects of current treatments still remain undesired. This study aims to investigate the role of C-CBL in retinal angiogenesis in ROP and its potential
Chia-Hao Chang et al.
Oncotarget, 8(19), 31199-31214 (2017-04-19)
Post-translational mechanisms regulating cell-matrix adhesion turnover during cell locomotion are not fully elucidated. In this study, we uncovered an essential role of Y118 site-specific tyrosine phosphorylation of paxillin, an adapter protein of focal adhesion complexes, in paxillin recruitment to autophagosomes
Chirayu Pandya et al.
Psychoneuroendocrinology, 45, 108-118 (2014-05-23)
Brain derived neurotrophic factor (BDNF) signaling through its receptor TrkB plays a crucial role in neurodevelopment and plasticity. Stress and glucocorticoids have been shown to alter TrkB signaling in neurons, and defects in TrkB expression have been reported in the
Y Gui et al.
Oncogene, 34(46), 5718-5728 (2015-03-03)
Suppressor of cytokine signaling 1 (SOCS1) is considered as a tumor suppressor protein in hepatocellular carcinoma (HCC), but the underlying mechanisms remain unclear. Previously, we have shown that SOCS1-deficient hepatocytes displayed increased responsiveness to hepatocyte growth factor (HGF) due to

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.