Direkt zum Inhalt
Merck

EHU022821

Sigma-Aldrich

MISSION® esiRNA

targeting human CXCR4

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CCGTGGCAAACTGGTACTTTGGGAACTTCCTATGCAAGGCAGTCCATGTCATCTACACAGTCAACCTCTACAGCAGTGTCCTCATCCTGGCCTTCATCAGTCTGGACCGCTACCTGGCCATCGTCCACGCCACCAACAGTCAGAGGCCAAGGAAGCTGTTGGCTGAAAAGGTGGTCTATGTTGGCGTCTGGATCCCTGCCCTCCTGCTGACTATTCCCGACTTCATCTTTGCCAACGTCAGTGAGGCAGATGACAGATATATCTGTGACCGCTTCTACCCCAATGACTTGTGGGTGGTTGTGTTCCAGTTTCAGCACATCATGGTTGGCCTTATCCTGCCTGGTATTGTCATCCTGTCCTGCTATTGCATTATCATCTCCAAGCTGTCACACTCCAAGGGCCACCAGAAGCGCAAGGCCCTCAAGACCACAGTCATCCTCATCCTGGCTTTCTTCGCCTGTTGGCTGCCTTACTACATTGGGATCAGCATCGACTC

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Lei Li et al.
Biochimica et biophysica acta. General subjects, 1862(8), 1790-1800 (2018-05-08)
HIV infection and/or the direct pathogenic effects of circulating HIV proteins impairs the physiological function of mesenchymal stem cells (MSCs), and contribute to the pathogenesis of age-related clinical comorbidities in people living with HIV. The SDF-1/CXCR4 pathway is vital for
Zhi-Yu Song et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 71, 46-52 (2015-05-12)
Chemokine CXCL12 is an extracellular chemokine, which binds to its cell surface receptor CXCR4. High expressions of CXCR4 and CXCL12 are associated with biological malignant potential in colon cancers. We aimed to investigate the roles of the CXCR4/CXCL12 axis in
Markus Eberl et al.
EMBO molecular medicine, 4(3), 218-233 (2012-02-02)
Inhibition of Hedgehog (HH)/GLI signalling in cancer is a promising therapeutic approach. Interactions between HH/GLI and other oncogenic pathways affect the strength and tumourigenicity of HH/GLI. Cooperation of HH/GLI with epidermal growth factor receptor (EGFR) signalling promotes transformation and cancer
Ying Wang et al.
Frontiers in oncology, 9, 1487-1487 (2020-02-13)
Purpose: Due to a lack of recognized molecular targets for therapy, patients with triple-negative breast cancer (TNBC), unlike other subtypes of breast cancers, generally have not benefited from the advances made with targeted agents. The CXCR4/SDF-1 axis is involved in
Nahyeon Kang et al.
BMC cancer, 19(1), 148-148 (2019-02-15)
A hypoxic microenvironment leads to an increase in the invasiveness and the metastatic potential of cancer cells within tumors via the epithelial-mesenchymal transition (EMT) and cancer stemness acquisition. However, hypoxia-induced changes in the expression and function of candidate stem cell

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.