Direkt zum Inhalt
Merck

EHU018671

Sigma-Aldrich

MISSION® esiRNA

targeting human SMAD4

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TGTGCCATAGACAAGGTGGAGAGAGTGAAACATTTGCAAAAAGAGCAATTGAAAGTTTGGTAAAGAAGCTGAAGGAGAAAAAAGATGAATTGGATTCTTTAATAACAGCTATAACTACAAATGGAGCTCATCCTAGTAAATGTGTTACCATACAGAGAACATTGGATGGGAGGCTTCAGGTGGCTGGTCGGAAAGGATTTCCTCATGTGATCTATGCCCGTCTCTGGAGGTGGCCTGATCTTCACAAAAATGAACTAAAACATGTTAAATATTGTCAGTATGCGTTTGACTTAAAATGTGATAGTGTCTGTGTGAATCCATATCACTACGAACGAGTTGTATCACCTGGAATTGATCTCTCAGGATTAACACTGCAGAGTAATGCTCCATCAAGTATGATGGTGAAGGATGAATATGTGCATGACTTTGAGGGACAGCCATCGTTGTCCACTGAAGGACATTCAATTCAAACCATCCAGCATCCACCAAGTAATCGTGCATCG

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA ist durch Endoribonuklease hergestellte siRNA. Dabei handelt es sich um eine heterogene Mischung von siRNA, die alle dieselbe mRNA-Zielsequenz haben. Diese mehrfachen Auslöser bewirken eine hochspezifische und wirksame Genstummschaltung.

Weitere Einzelheiten sowie eine Darstellung aller erhältlichen esiRNA-Produkte finden Sie unter SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

12 - Non Combustible Liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Ryotaro Ogawa et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 25(9), 2887-2899 (2019-02-02)
SMAD4 is a key transcriptional factor of TGFβ signaling and acts as a tumor suppressor in colorectal cancer. In the present study, we explored the immunologic effect of SMAD4 on the tumor microenvironment. Using 99 clinical specimens and human colorectal
Mao Ding et al.
Journal of experimental & clinical cancer research : CR, 39(1), 28-28 (2020-02-06)
Sirtuin-7 (SIRT7) is associated with the maintenance of tumorigenesis. However, its functional roles and oncogenic mechanisms in prostate cancer (PCa) are poorly understood. Here, we investigated the roles and underlying molecular mechanisms of SIRT7 in PCa cell growth and androgen-induced
Xiaojiang Tang et al.
Journal of cellular biochemistry, 121(11), 4642-4653 (2020-02-13)
As an aggressive breast cancer (BCa) subtype, triple-negative breast cancer (TNBC) responses poorly to chemotherapy and endocrine therapy, and usually has a worse prognosis. This is largely due to the lack of specific therapeutic targets, laying claim to an imperious
Ri Youn Kim et al.
Tissue engineering. Part A, 21(13-14), 2076-2088 (2015-04-04)
Clinical data show that estrogen levels are inversely associated with the production of sclerostin, a Wnt antagonist that recently attracted great attention over the use of its antibody in the anabolic treatment of osteoporotic conditions. However, the molecular link between
Li Liu et al.
International journal of oncology, 53(6), 2780-2788 (2018-10-16)
Helicase‑like transcription factor (HLTF) has been identified as a tumor suppressor gene. The hypermethylation of HTLF is frequently observed in various types of cancer, including colorectal cancer (CRC). However, the mechanisms through which HLTF suppresses CRC progression remain unclear. Thus, the

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.