Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU149911

Sigma-Aldrich

MISSION® esiRNA

targeting human CSPG4

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACTACAGGGCACAAGGCTGTCAGATGGCCAGGGCTTCACCCAGGATGACATACAGGCTGGCCGGGTGACCTATGGGGCCACAGCACGTGCCTCAGAGGCAGTCGAGGACACCTTCCGTTTCCGTGTCACAGCTCCACCATATTTCTCCCCACTCTATACCTTCCCCATCCACATTGGTGGTGACCCAGATGCGCCTGTCCTCACCAATGTCCTCCTCGTGGTGCCTGAGGGTGGTGAGGGTGTCCTCTCTGCTGACCACCTCTTTGTCAAGAGTCTCAACAGTGCCAGCTACCTCTATGAGGTCATGGAGCGGCCCCGCCATGGGAGGTTGGCTTGGCGTGGGACACAGGACAAGACCACTATGGTGACATCCTTCACCAATGAAGACCTGTTGCGTGGCCGGCTGGTCTACCAGCATGATGACTCCGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Jianbo Yang et al.
Melanoma research, 29(4), 365-375 (2019-05-30)
Chondroitin sulfate proteoglycan 4 (CSPG4) is a cell surface proteoglycan that enhances malignant potential in melanoma and several other tumor types. CSPG4 functions as a transmembrane scaffold in melanoma cells to activate oncogenic signaling pathways such as focal adhesion kinase
Sridevi Yadavilli et al.
Oncotarget, 6(14), 12141-12155 (2015-05-20)
Diffuse intrinsic pontine gliomas (DIPGs) have a dismal prognosis and are poorly understood brain cancers. Receptor tyrosine kinases stabilized by neuron-glial antigen 2 (NG2) protein are known to induce gliomagenesis. Here, we investigated NG2 expression in a cohort of DIPG
Frank Maus et al.
PloS one, 10(9), e0137311-e0137311 (2015-09-05)
The NG2 proteoglycan is characteristically expressed by oligodendrocyte progenitor cells (OPC) and also by aggressive brain tumours highly resistant to chemo- and radiation therapy. Oligodendrocyte-lineage cells are particularly sensitive to stress resulting in cell death in white matter after hypoxic

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico