Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU144011

Sigma-Aldrich

MISSION® esiRNA

targeting human APEX1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCCCAGATCAGAAAACCTCACCCAGTGGCAAACCTGCCACACTCAAGATCTGCTCTTGGAATGTGGATGGGCTTCGAGCCTGGATTAAGAAGAAAGGATTAGATTGGGTAAAGGAAGAAGCCCCAGATATACTGTGCCTTCAAGAGACCAAATGTTCAGAGAACAAACTACCAGCTGAACTTCAGGAGCTGCCTGGACTCTCTCATCAATACTGGTCAGCTCCTTCGGACAAGGAAGGGTACAGTGGCGTGGGCCTGCTTTCCCGCCAGTGCCCACTCAAAGTTTCTTACGGCATAGGCGATGAGGAGCATGATCAGGAAGGCCGGGTGATTGTGGCTGAATTTGACTCGTTTGTGCTGGTAACAGCATATGTACCTAATGCAGGCCGAGGTCTGGTACGACTGGAGTACCGGCAGCGCTGGGATGAAGCCTTTCGCAAGTTCCTGAAGGGCCTGGCTTCCCGAAAGCCCCTTGTGCTGTGTGGAGACCTC

Ensembl | human accession no.

ENSG00000100823

NCBI accession no.

NM_001641

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... APEX1(328) , APEX1(328)

Categorías relacionadas

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Mengxia Li et al.
Nucleic acids research, 46(11), 5664-5677 (2018-05-12)
Base excision repair (BER) handles many forms of endogenous DNA damage, and apurinic/apyrimidinic endonuclease 1 (APE1) is central to this process. Deletion of both alleles of APE1 (a.k.a. Apex1) in mice leads to embryonic lethality, and deficiency in cells can
Aaron M Fleming et al.
Proceedings of the National Academy of Sciences of the United States of America, 114(10), 2604-2609 (2017-02-02)
Reactive oxygen species (ROS) have emerged as important cellular-signaling agents for cellular survival. Herein, we demonstrate that ROS-mediated oxidation of DNA to yield 8-oxo-7,8-dihydroguanine (OG) in gene promoters is a signaling agent for gene activation. Enhanced gene expression occurs when
Shu-Ting Pan et al.
BMC cancer, 20(1), 634-634 (2020-07-10)
Drug resistance is a major cause of therapeutic failure that is often associated with elevated autophagy and apurinic/apyrimidinic endonuclease 1 (APE1) expression. Herein, we investigated the role of APE1 and autophagy in A549 cells treated with cisplatin. SILAC proteomics was
Nasrin Akhter et al.
The Journal of biological chemistry, 291(45), 23672-23680 (2016-09-18)
Apurinic/apyrimidinic endonuclease 1/redox factor-1 (Ape1/Ref-1) is a multifunctional protein possessing DNA repair, redox control, and transcriptional regulatory activities. Although Ape1/Ref-1 plays multiple roles in the immune system, its functions in helper T (Th) cell activation and differentiation are largely unknown.
Hong-Beum Kim et al.
Annals of surgical treatment and research, 92(1), 15-22 (2017-01-17)
Biliary cancer is a highly malignant neoplasm with poor prognosis and most patients need to undergo palliative chemotherapy, however major clinical problem associated with the use of chemotherapy is chemoresistance. So far, we aimed at investigating clinical implications of apurinic/apyrimidinic
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico