Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU129311

Sigma-Aldrich

MISSION® esiRNA

targeting human ADAM10

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCGAACTCTGCCATTTCACTCTGTCATTTATCATGAAGATGATATTAACTATCCCCATAAATACGGTCCTCAGGGGGGCTGTGCAGATCATTCAGTATTTGAAAGAATGAGGAAATACCAGATGACTGGTGTAGAGGAAGTAACACAGATACCTCAAGAAGAACATGCTGCTAATGGTCCAGAACTTCTGAGGAAAAAACGTACAACTTCAGCTGAAAAAAATACTTGTCAGCTTTATATTCAGACTGATCATTTGTTCTTTAAATATTACGGAACACGAGAAGCTGTGATTGCCCAGATATCCAGTCATGTTAAAGCGATTGATACAATTTACCAGACCACAGACTTCTCCGGAATCCGTAACATCAGTTTCATGGTGAAACGCATAAGAATCAATACAACTGCTGATGAGAAGGACCCTACAAATCCTTTCCGTTTCCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Zikang Xie et al.
Environmental toxicology, 35(8), 867-878 (2020-03-22)
MiR-20a has been reported as a key regulator to pro-inflammatory factor release in fibroblast-like synoviocytes (FLS), which caused rheumatoid arthritis (RA). However, the molecular mechanism of miR-20a in RA remains to be further elucidated. This study aimed to investigate the
Jun Lu et al.
Cancer management and research, 12, 9577-9587 (2020-10-17)
Non-small cell lung cancer (NSCLC) remains the most commonly diagnosed malignancy and the leading cause of cancer death worldwide. Circular RNAs (circRNAs) have been demonstrated to play critical roles in human carcinogenesis, including NSCLC. However, it is still unclear whether
Chuanjin Ding et al.
Oncology reports, 38(2), 866-874 (2017-06-29)
The aim of this study was to determine the effect of A disintegrin and metalloprotease 10 (ADAM10) protein expression on the progression, migration and prognosis of hypopharyngeal squamous cell carcinoma (HSCC). Immunohistochemistry and western blot analysis were performed to detect ADAM10
Jessica Pruessmeyer et al.
Blood, 123(26), 4077-4088 (2014-05-17)
Inflammation is a key process in various diseases, characterized by leukocyte recruitment to the inflammatory site. This study investigates the role of a disintegrin and a metalloproteinase (ADAM) 10 and ADAM17 for leukocyte migration in vitro and in a murine
Xiufen Liu et al.
Communications biology, 3(1), 728-728 (2020-12-03)
Mesothelin (MSLN) is a lineage restricted cell surface protein expressed in about 30% of human cancers and high MSLN expression is associated with poor survival in several different cancers. The restricted expression of MSLN in normal tissue and its frequent

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico