Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU113511

Sigma-Aldrich

MISSION® esiRNA

targeting human BAK1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAACCGACGCTATGACTCAGAGTTCCAGACCATGTTGCAGCACCTGCAGCCCACGGCAGAGAATGCCTATGAGTACTTCACCAAGATTGCCACCAGCCTGTTTGAGAGTGGCATCAATTGGGGCCGTGTGGTGGCTCTTCTGGGCTTCGGCTACCGTCTGGCCCTACACGTCTACCAGCATGGCCTGACTGGCTTCCTAGGCCAGGTGACCCGCTTCGTGGTCGACTTCATGCTGCATCACTGCATTGCCCGGTGGATTGCACAGAGGGGTGGCTGGGTGGCAGCCCTGAACTTGGGCAATGGTCCCATCCTGAACGTGCTGGTGGTTCTGGGTGTGGTTCTGTTGGGCCAGTTTGTGGTACGAAGATTCTTCAAATCATGACTCCCAAGGGTGCCCTTTGGGGTCCCGGTTCAGACCCCTGCCTGGACTTAAGCGAAGTCTTTGCCTTCTCTGTTCCCTTGCAG

Ensembl | human accession no.

ENSG00000030110

NCBI accession no.

NM_001188

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... BAK1(578) , BAK1(578)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Shunnan Yao et al.
Cancer letters, 483, 87-97 (2020-04-09)
Hepatocellular carcinoma (HCC) is a common malignancy with a poor prognosis. Dimethylaminomicheliolide (DMAMCL) is a novel antitumor agent that has been tested in phase I clinical trials; however, little is known regarding its effects in HCC. In this study, we
Rong Zhang et al.
Cell death & disease, 9(6), 598-598 (2018-05-24)
Hirsutine extracted from Uncaria rhynchophylla has been shown to exhibit anti-cancer activity. However, the molecular mechanism by which hirsutine exhibits anti-lung cancer activity remains unclear. In the present study, we showed that hirsutine induces apoptosis in human lung cancer cells
Melissa Desouza-Armstrong et al.
Cytoskeleton (Hoboken, N.J.), 74(6), 233-248 (2017-04-06)
The actin cytoskeleton is a polymer system that acts both as a sensor and mediator of apoptosis. Tropomyosins (Tpm) are a family of actin binding proteins that form co-polymers with actin and diversify actin filament function. Previous studies have shown
Yumi Uetake et al.
Molecular biology of the cell, 29(22), 2632-2643 (2018-08-23)
When untransformed human cells spend >1.5 h in prometaphase under standard culture conditions, all daughters arrest in G1 despite normal division of their mothers. We investigate what happens during prolonged prometaphase that leads to daughter cell arrest in the absence
Haiyan Tan et al.
Oncotarget, 6(36), 39184-39195 (2015-10-10)
Prostate cancer is the second most commonly diagnosed cancer among men in the United States. Prostate cancer therapy is severely hampered by lack of response and development of resistance to conventional chemotherapeutic drugs in patients. Therefore, the development and discovery
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico