Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU076641

Sigma-Aldrich

MISSION® esiRNA

targeting human JARID2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCCTTTTGCAATCAGCATTTGGATCTCAGAATGAGCAAGGAAAGACCCAAGAGGAATATCATTCAGAAGAAATACGATGACAGTGATGGGATTCCGTGGTCAGAAGAACGGGTGGTACGTAAAGTCCTTTATTTGTCTCTGAAGGAGTTCAAGAATTCCCAGAAGAGGCAGCATGCGGAAGGCATTGCTGGGAGCCTGAAAACTGTGAATGGGCTCCTTGGTAATGACCAGTCTAAGGGATTAGGACCAGCATCAGAACAGTCAGAGAATGAAAAGGACGATGCATCCCAAGTGTCCTCCACTAGCAACGATGTTAGTTCTTCAGATTTTGAAGAAGGGCCGTCGAGGAAAAGGCCCAGGCTGCAAGCACAAAGGAAGTTTGCTCAGTCTCAGCCGAATAGTCCCAGCACAACTCCAGTAAAGATAGTGGAGCCATTGCTACCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Diaa Al-Raawi et al.
The EMBO journal, 38(3) (2018-12-24)
Polycomb repressive complex-2 (PRC2) is a group of proteins that play an important role during development and in cell differentiation. PRC2 is a histone-modifying complex that catalyses methylation of lysine 27 of histone H3 (H3K27me3) at differentiation genes leading to
Dandan Liang et al.
International journal of cardiology, 201, 38-48 (2015-08-25)
In mammals, the heart grows by hypertrophy but not proliferation of cardiomyocytes after birth. The paucity of cardiomyocyte proliferation limits cardiac regeneration in a variety of heart diseases. To explore the efficient strategies that drive cardiomyocyte proliferation, we employed in
Chang-Liang Su et al.
International journal of hematology, 102(1), 76-85 (2015-05-06)
It has recently been shown that JARID2 contributes to the malignant character of solid tumors, such as epithelial-mesenchymal transition in lung and colon cancer cell lines, but its role in leukemia progression is unexplored. In this study, we explored the

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico