Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU067061

Sigma-Aldrich

MISSION® esiRNA

targeting human PRKCD

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAGTCTATGCGCAGTGAGGACGAGGCCAAGTTCCCAACGATGAACCGCCGCGGAGCCATCAAACAGGCCAAAATCCACTACATCAAGAACCATGAGTTTATCGCCACCTTCTTTGGGCAACCCACCTTCTGTTCTGTGTGCAAAGACTTTGTCTGGGGCCTCAACAAGCAAGGCTACAAATGCAGGCAATGTAACGCTGCCATCCACAAGAAATGCATCGACAAGATCATCGGCAGATGCACTGGCACCGCGGCCAACAGCCGGGACACTATATTCCAGAAAGAACGCTTCAACATCGACATGCCGCACCGCTTCAAGGTTCACAACTACATGAGCCCCACCTTCTGTGACCACTGCGGCAGCCTGCTCTGGGGACTGGTGAAGCAGGGATTAAAGTGTGAAGACTGCGGCAT

Ensembl | human accession no.

ENSG00000163932

NCBI accession no.

NM_006254

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PRKCD(5580) , PRKCD(5580)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Markus Dietrich et al.
Experimental cell research, 382(2), 111473-111473 (2019-06-25)
ErbB3, which belongs to the epidermal growth factor receptor (EGFR) or ErbB family of receptor tyrosine kinases, is involved in progression of several human cancers and a tight regulation of its expression is crucial. An important mechanism for regulation of
Zoé Lama et al.
Antiviral research, 168, 51-60 (2019-05-10)
Rabies virus (RABV) is a neurotropic virus that causes fatal encephalitis in humans and animals and still kills up to 59,000 people worldwide every year. To date, only preventive or post-exposure vaccination protects against the disease but therapeutics are missing.
Sara G Pollan et al.
Oncogene, 37(21), 2817-2836 (2018-03-08)
Tumor metastasis depends on the dynamic regulation of cell adhesion through β1-integrin. The Cub-Domain Containing Protein-1, CDCP1, is a transmembrane glycoprotein which regulates cell adhesion. Overexpression and loss of CDCP1 have been observed in the same cancer types to promote
Fumihiko Urabe et al.
Science advances, 6(18), eaay3051-eaay3051 (2020-06-05)
Extracellular vesicles (EVs) are involved in intercellular communication during cancer progression; thus, elucidating the mechanism of EV secretion in cancer cells will contribute to the development of an EV-targeted cancer treatment. However, the biogenesis of EVs in cancer cells is

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico