Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU054291

Sigma-Aldrich

MISSION® esiRNA

targeting human NNMT

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGACAAGAAGGGCTGAACTGATGGAAGGAATGCTGTTAGCCTGAGACTCAGGAAGACAACTTCTGCAGGGTCACTCCCTGGCTTCTGGAGGAAAGAGAAGGAGGGCAGTGCTCCAGTGGTACAGAAGTGAGACATAATGGAATCAGGCTTCACCTCCAAGGACACCTATCTAAGCCATTTTAACCCTCGGGATTACCTAGAAAAATATTACAAGTTTGGTTCTAGGCACTCTGCAGAAAGCCAGATTCTTAAGCACCTTCTGAAAAATCTTTTCAAGATATTCTGCCTAGACGGTGTGAAGGGAGACCTGCTGATTGACATCGGCTCTGGCCCCACTATCTATCAGCTCCTCTCTGCTTGTGAATCCTTTAAGGAGATCGTCGTCACTGACTACTCAGACCAGAACCTGCAGGAGCTGGAGAAGTGGCTGAAGAAAGAGCCAGAGGCCT

Ensembl | human accession no.

ENSG00000166741

NCBI accession no.

NM_006169

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... NNMT(4837) , NNMT(4837)

Categorías relacionadas

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yanyan Cui et al.
Molecular carcinogenesis, 59(8), 940-954 (2020-05-06)
Esophageal squamous cell carcinoma (ESCC) is a common malignant tumor with poor prognosis. And different individuals respond to the same drug differently. Increasing evidence has confirmed that metabolism reprogramming was involved in the drug sensitivity of tumor cells. However, the
Yanzhong Wang et al.
Breast cancer research : BCR, 21(1), 64-64 (2019-05-19)
Nicotinamide N-methyltransferase (NNMT) is overexpressed in various human tumors and involved in the development and progression of several carcinomas. In breast cancer, NNMT was found to be overexpressed in several cell lines. However, the clinical relevance of NNMT in breast
Yanyan Cui et al.
Molecular and cellular biochemistry, 460(1-2), 93-103 (2019-07-07)
Nicotinamide N-methyltransferase (NNMT) is an important methyltransferase involved in the biotransformation of many drugs and exogenous compounds. Abnormal expression of NNMT protein is closely associated with the onset and progression of many malignancies, but little is known about its role
Bashar M Thejer et al.
BMC molecular and cell biology, 21(1), 26-26 (2020-04-16)
Progesterone receptor membrane component 1 (PGRMC1) is often elevated in cancers, and exists in alternative states of phosphorylation. A motif centered on PGRMC1 Y180 was evolutionarily acquired concurrently with the embryological gastrulation organizer that orchestrates vertebrate tissue differentiation. Here, we

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico