Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU052661

Sigma-Aldrich

MISSION® esiRNA

targeting human CSF1R

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGGAGGCGTCGACTATAAGAACATCCACCTCGAGAAGAAATATGTCCGCAGGGACAGTGGCTTCTCCAGCCAGGGTGTGGACACCTATGTGGAGATGAGGCCTGTCTCCACTTCTTCAAATGACTCCTTCTCTGAGCAAGACCTGGACAAGGAGGATGGACGGCCCCTGGAGCTCCGGGACCTGCTTCACTTCTCCAGCCAAGTAGCCCAGGGCATGGCCTTCCTCGCTTCCAAGAATTGCATCCACCGGGACGTGGCAGCGCGTAACGTGCTGTTGACCAATGGTCATGTGGCCAAGATTGGGGACTTCGGGCTGGCTAGGGACATCATGAATGACTCCAACTACATTGTCAAGGGCAATGCCCGCCTGCCTGTGAAGTGGATGGCCCCAGAGAGCATCTTTGACTGTGTCTACACGGTTCAGAGCGACGTCTGGTCCTATGGCATCCTC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Ladonya Jackson et al.
Journal of neuroinflammation, 17(1), 137-137 (2020-04-30)
Unfortunately, over 40% of stroke victims have pre-existing diabetes which not only increases their risk of stroke up to 2-6 fold, but also worsens both functional recovery and the severity of cognitive impairment. Our lab has recently linked the chronic
Thidarath Rattanaburee et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 129, 110361-110361 (2020-06-15)
Kusunokinin, a lignan compound, inhibits cancer cell proliferation and induces apoptosis; however, the role of kusunokinin is not fully understood. Here, we aimed to identify a target protein of (-)-kusunokinin and determine the protein levels of its downstream molecules. We
Xiaolong Shi et al.
Cellular and molecular gastroenterology and hepatology, 10(2), 391-418 (2020-04-19)
The miR-34a gene is a direct target of p53 and is commonly silenced in colorectal cancer (CRC). Here we identified the receptor tyrosine kinase CSF1R as a direct miR-34a target and characterized CSF1R as an effector of p53/miR-34a-mediated CRC suppression.
Qiang Chen et al.
Fish & shellfish immunology, 45(2), 386-398 (2015-05-10)
Colony-stimulating factor 1 receptor (CSF1R) is an important regulator of monocytes/macrophages (MO/MΦ). Although CSF1R gene has been identified and functionally studied in many fish, the precise role of CSF1R in grass carp (Ctenopharyngodon idellus) remains unclear. In this study, we

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico