Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU032851

Sigma-Aldrich

MISSION® esiRNA

targeting human CBL

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CATCCTGGCTACATGGCTTTTTTGACGTATGACGAAGTGAAAGCTCGGCTCCAGAAATTCATTCACAAACCTGGCAGTTATATCTTCCGGCTGAGCTGTACTCGTCTGGGTCAGTGGGCTATTGGGTATGTTACTGCTGATGGGAACATTCTCCAGACAATCCCTCACAATAAACCTCTCTTCCAAGCACTGATTGATGGCTTCAGGGAAGGCTTCTATTTGTTTCCTGATGGACGAAATCAGAATCCTGATCTGACTGGCTTATGTGAACCAACTCCCCAAGACCATATCAAAGTGACCCAGGAACAATATGAATTATACTGTGAGATGGGCTCCACATTCCAACTATGTAAAATATGTGCTGAAAATGATAAGGATGTAAAGATTGAGCCCTGTGGACACCTCATGTGCACATCCTGTCTTACATCCTGGCAGGAATCAGAAGGTCAGGGCTGTCCTTTCTGCCGATGTGAAAT

Ensembl | human accession no.

ENSG00000110395

NCBI accession no.

NM_005188

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CBL(867) , CBL(867)

Categorías relacionadas

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Ying Hong et al.
Neurology. Genetics, 6(4), e448-e448 (2020-07-09)
To report a series of patients with cerebral arteriopathy associated with heterozygous variants in the casitas B-lineage lymphoma (CBL) gene and examine the functional role of the identified mutant Cbl protein. We hypothesized that mutated Cbl fails to act as
Shimei Chen et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 132, 110856-110856 (2020-10-31)
The incidence of retinopathy of prematurity (ROP) has increased continuously in recent years. However, the therapeutic effects of current treatments still remain undesired. This study aims to investigate the role of C-CBL in retinal angiogenesis in ROP and its potential
Chia-Hao Chang et al.
Oncotarget, 8(19), 31199-31214 (2017-04-19)
Post-translational mechanisms regulating cell-matrix adhesion turnover during cell locomotion are not fully elucidated. In this study, we uncovered an essential role of Y118 site-specific tyrosine phosphorylation of paxillin, an adapter protein of focal adhesion complexes, in paxillin recruitment to autophagosomes
Chirayu Pandya et al.
Psychoneuroendocrinology, 45, 108-118 (2014-05-23)
Brain derived neurotrophic factor (BDNF) signaling through its receptor TrkB plays a crucial role in neurodevelopment and plasticity. Stress and glucocorticoids have been shown to alter TrkB signaling in neurons, and defects in TrkB expression have been reported in the
Y Gui et al.
Oncogene, 34(46), 5718-5728 (2015-03-03)
Suppressor of cytokine signaling 1 (SOCS1) is considered as a tumor suppressor protein in hepatocellular carcinoma (HCC), but the underlying mechanisms remain unclear. Previously, we have shown that SOCS1-deficient hepatocytes displayed increased responsiveness to hepatocyte growth factor (HGF) due to

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico