Skip to Content
Merck
All Photos(1)

Documents

EHU029271

Sigma-Aldrich

MISSION® esiRNA

targeting human GFAP

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTGGTGAAGACCGTGGAGATGCGGGATGGAGAGGTCATTAAGGAGTCCAAGCAGGAGCACAAGGATGTGATGTGAGGCAGGACCCACCTGGTGGCCTCTGCCCCGTCTCATGAGGGGCCCGAGCAGAAGCAGGATAGTTGCTCCGCCTCTGCTGGCACATTTCCCCAGACCTGAGCTCCCCACCACCCCAGCTGCTCCCCTCCCTCCTCTGTCCCTAGGTCAGCTTGCTGCCCTAGGCTCCGTCAGTATCAGGCCTGCCAGACGGCACCCACCCAGCACCCAGCAACTCCAACTAACAAGAAACTCACCCCCAAGGGGCAGTCTGGAGGGGCATGGCCAGCAGCTTGCGTTAGAATGAGGAGGAAGGAGAGAAGGGGAGGAGGGCGGGGGGCACCTACTACATCGCCCTCCACATC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jong-Hyun Moon et al.
Journal of veterinary science, 16(2), 203-211 (2014-10-02)
In the present study, the use of dogs with experimental autoimmune encephalomyelitis (EAE) as a disease model for necrotizing encephalitis (NE) was assessed. Twelve healthy dogs were included in this study. Canine forebrain tissues (8 g), including white and grey
Se Jeong Lee et al.
BMC cancer, 15, 1011-1011 (2015-12-26)
Glioblastoma multiforme (GBM) is characterized by extensive local invasion, which is in contrast with extremely rare systemic metastasis of GBM. Molecular mechanisms inhibiting systemic metastasis of GBM would be a novel therapeutic candidate for GBM in the brain. Patient-derived GBM
Amy Treadwell et al.
Veterinary ophthalmology, 18(5), 371-380 (2014-09-02)
To characterize the clinical, diagnostic, and histopathologic findings in dogs with canine ocular gliovascular syndrome (COGS). The archives at the Comparative Ocular Pathology Laboratory of Wisconsin (COPLOW) were used to identify eyes with COGS. Histopathological inclusion criteria included: a neovascular

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service