Skip to Content
Merck
All Photos(1)

Key Documents

EHU024531

Sigma-Aldrich

MISSION® esiRNA

targeting human MAP3K14

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACTGAGGACAACGAGGGTGTCCTGCTCACTGAGAAACTCAAGCCAGTGGATTATGAGTACCGAGAAGAAGTCCACTGGGCCACGCACCAGCTCCGCCTGGGCAGAGGCTCCTTCGGAGAGGTGCACAGGATGGAGGACAAGCAGACTGGCTTCCAGTGCGCTGTCAAAAAGGTGCGGCTGGAAGTATTTCGGGCAGAGGAGCTGATGGCATGTGCAGGATTGACCTCACCCAGAATTGTCCCTTTGTATGGAGCTGTGAGAGAAGGGCCTTGGGTCAACATCTTCATGGAGCTGCTGGAAGGTGGCTCCCTGGGCCAGCTGGTCAAGGAGCAGGGCTGTCTCCCAGAGGACCGGGCCCTGTACTACCTGGGCCAGGCCCTGGAGGGTCTGGAATACCTCCACTCACGAAGGATTCTGCA

Ensembl | human accession no.

ENSG00000006062

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... MAP3K14(9020) , MAP3K14(9020)

Related Categories

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Kislay Parvatiyar et al.
Nature communications, 9(1), 2770-2770 (2018-07-19)
Detection of viral genomes by the innate immune system elicits an antiviral gene program mediated by type I interferons (IFNs). While viral RNA and DNA species induce IFN via separate pathways, the mechanisms by which these pathways are differentially modulated
Miles C Duncan et al.
PloS one, 12(2), e0171406-e0171406 (2017-02-07)
Infection of human cells with Yersinia pseudotuberculosis expressing a functional type III secretion system (T3SS) leads to activation of host NF-κB. We show that the Yersinia T3SS activates distinct NF-κB pathways dependent upon bacterial subcellular localization. We found that wildtype
Po Y Mak et al.
British journal of haematology, 167(3), 376-384 (2014-08-01)
Overexpression of the apoptosis repressor with caspase recruitment domain (ARC, also termed NOL3) protein predicts adverse outcome in patients with acute myeloid leukaemia (AML) and confers drug resistance to AML cells. The second mitochondrial-derived activator of caspases (SMAC, also termed
Paulina Kucharzewska et al.
Journal of cell science, 132(7) (2019-03-07)
NF-κB-inducing kinase (NIK; also known as MAP3K14) is a central regulator of non-canonical NF-κB signaling in response to stimulation of TNF receptor superfamily members, such as the lymphotoxin-β receptor (LTβR), and is implicated in pathological angiogenesis associated with chronic inflammation
Katharina Mörs et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 43(1), 17-30 (2017-08-30)
Alcohol (ethanol, EtOH) as significant contributor to traumatic injury is linked to suppressed inflammatory response, thereby influencing clinical outcomes. Alcohol-induced immune-suppression during acute inflammation (trauma) was linked to nuclear factor-kappaB (NF-ĸB). Here, we analyzed alcohol`s effects and mechanisms underlying its
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service