HLTUD002C
MISSION® Lenti microRNA Inhibitor
cel-miR-243-3p, Negative Control 2, Sequence from Caenorhabditis elegans with no homology to human and mouse gene sequences
Synonym(s):
Tough Decoy, TuD
Sign Into View Organizational & Contract Pricing
All Photos(1)
About This Item
UNSPSC Code:
41106609
NACRES:
NA.51
Recommended Products
Quality Level
product line
MISSION®
form
liquid
concentration
≥1x106 VP/ml (via p24 assay)
mature sequence
CGGUACGAUCGCGGCGGGAUAUC
Sanger mature/minor accession no.
Sanger microRNA accession no.
shipped in
dry ice
storage temp.
−70°C
Looking for similar products? Visit Product Comparison Guide
General description
Individual lenti microRNA inhibitors are designed using a proprietary algorithm, which is based on the work of Haraguchi, T, et al. and in collaboration with Dr. Hideo Iba, University of Tokyo. This algorithm utilizes the tough decoy (TuD) design. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation. The lentiviral microRNA Inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can be used to transduce mammalian cells. Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element2 (WPRE) is included, allowing for enhanced expression of transgenes delivered by lentiviral vectors. This lentiviral vector also carries a puromycin resistance gene for selection of cells.
- Allows for potent inhibition of the desired miRNA
- Lentiviral delivery format allows for efficient delivery of the inhibitor into a wide variety of cell types
- Enables long-term inhibition without repeat transfection
Other Notes
Based on miRBase V19 Mature ID
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
12 - Non Combustible Liquids
wgk_germany
WGK 3
flash_point_f
Not applicable
flash_point_c
Not applicable
Certificates of Analysis (COA)
Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Ruben Aquino-Martinez et al.
Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research, 34(1), 135-144 (2018-10-16)
Developing novel approaches to treat skeletal disorders requires an understanding of how critical molecular factors regulate osteoblast differentiation and bone remodeling. We have reported that (1) retinoic acid receptor-related orphan receptor beta (Rorβ) is upregulated in bone samples isolated from
Yang Wang et al.
Journal of cellular biochemistry (2019-03-02)
Spinal cord injury (SCI) has been a major burden on the society because of the high rate of disability. Receptor-interacting protein 3 (RIP3)-mediated necroptosis is a newly discovered pathway of programmed cell death and is involved in multiple pathologies of
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service